View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11825_high_18 (Length: 397)
Name: NF11825_high_18
Description: NF11825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11825_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 62 - 307
Target Start/End: Original strand, 25716938 - 25717183
Alignment:
| Q |
62 |
ttaactttatagttcaatgctgtatcagaaataatggggttatctcaattttgagannnnnnngtgtttttcagcctgctgtgtcaattgggaatgttgg |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25716938 |
ttaactttatagttcaatgctgtatcagaaataatggggttatctcaattttgtgatttttgtgtgtttttcagcctgctgtgtcaattgggaatgttgg |
25717037 |
T |
 |
| Q |
162 |
gcagttaacagcagaccttttggtttcatcaatgggttctgagaaagttggttacttggatgatccttatgttctcccttgtgttggcaatgatgcttat |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25717038 |
gcagttaacagcagaccttttggtttcatcaatgggttctgagaaagttggttacttggatgatccttatgttcttccttgtgttggcaatgatgcttat |
25717137 |
T |
 |
| Q |
262 |
ggaccttttcctcttggagaccttgcccttcctcttgaaggtgctt |
307 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25717138 |
ggaccttttcctcaaggagaccttgcccttcctcttgaaggtgctt |
25717183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 25716866 - 25716915
Alignment:
| Q |
1 |
tattttcccaattcattcatatatcttagattctaagtatctttattcat |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25716866 |
tattttcccaattcattcatatatcttagattctaggtatctttattcat |
25716915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University