View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11825_high_21 (Length: 322)
Name: NF11825_high_21
Description: NF11825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11825_high_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 19 - 311
Target Start/End: Original strand, 47151221 - 47151510
Alignment:
| Q |
19 |
gttcctcttttgctagatcttcaagtatgtttcatcttaactcttgcaaagttgcaagaaacaaaaagaactaaactaatttgttttgaaattttgttta |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47151221 |
gttcctcttttgctagatcttcaagtatgtttcatcttaactcttgcaaagttgcaagaaacaaaaagaactaaact---ttgttttgaaattttgttta |
47151317 |
T |
 |
| Q |
119 |
ggttgaagagagtagatacttgtttgaagcaaaaacgattaaaaagatggaaattttgatactttcaactcttggatggaagatgagtccagcaacacct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
47151318 |
ggttgaagagagtagatacttgtttgaagcaaaaacgattaaaaagatggaaattttgatactttcaactcttggatggaagatgaatccagcaacacct |
47151417 |
T |
 |
| Q |
219 |
ctttcttttattgattttatcataagaagacttggattgaaagatcatctaatttgttgggagttccttaagagatgtgaaggtgttcatctc |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
47151418 |
ctttcttttattgattttatcataagaagacttggattgaaagaccatctaatttgttgggagtttcttaagagatgtgaaggtgttcttctc |
47151510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University