View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11825_high_30 (Length: 250)
Name: NF11825_high_30
Description: NF11825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11825_high_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 16691669 - 16691425
Alignment:
| Q |
1 |
agaatagaataaaccttatactgcacatttttcagccactcttttcattataaaatagttcctctttcattttctttcttgcagaagaaatttctgatac |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
16691669 |
agaatagaataaaccttatactacacatttttcaaccactcttttcattataaaatagttcctctttcattttctttcttgcagaagaaatttctgatcc |
16691570 |
T |
 |
| Q |
101 |
atccatccaaaatcaaggctcagtaccttccatgtcttcttgtgaagcagttcagaatttcaagtaattaaaagattttctttataacttgatgctgtta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
16691569 |
atccatccaaaatcaaggctcagtaccttccatgtcttcttgtgaagcagttcagaatttcaagtaattaaaagattttctttataacttcatgctgtta |
16691470 |
T |
 |
| Q |
201 |
aaatatctgtgactatattaactataatagttatttgcctttgct |
245 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
16691469 |
aaatatctgtgacaatattaactataatagttatttgcctgtgct |
16691425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University