View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11825_low_31 (Length: 247)
Name: NF11825_low_31
Description: NF11825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11825_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 2 - 231
Target Start/End: Complemental strand, 38377431 - 38377202
Alignment:
| Q |
2 |
gaagcctcggaaaattgagctgaagacaagggacgatacacctgatattagtaacctgcaaaagtgtgctgattttgtccatgcttggttttgatgttat |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38377431 |
gaagcctcggaaaattgagctgaagacaagggacgatacacctgatattagtaacctgcaaaagtgtgctgattttgtccatgcttggttttgatgttat |
38377332 |
T |
 |
| Q |
102 |
agatgctattgctcttctgcgtttagatgaactctatgttgagtcctttgagatcaaggatgttaagacacttcgtggcgatcacttgtctcgtgcaatt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38377331 |
agatgctattgctcttctgcgtttagatgaactctatgttgagtcctttgagatcaaggatgttaagacacttcgtggcgatcacttgtctcgtgcaatt |
38377232 |
T |
 |
| Q |
202 |
ggaagattgtctggaaaacttggaaagacc |
231 |
Q |
| |
|
|||||||||||| |||||||||| |||||| |
|
|
| T |
38377231 |
ggaagattgtctagaaaacttggtaagacc |
38377202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 16 - 219
Target Start/End: Original strand, 24272288 - 24272499
Alignment:
| Q |
16 |
ttgagctgaagacaagggacgatacacctgatattagtaacctgcaaaagtgtgctgattttgtccatgctt--------ggttttgatgttatagatgc |
107 |
Q |
| |
|
||||||||||||||||| ||||||||||||| || |||||||||||||| |||||||||||||||||||||| ||||||||||| || ||||| |
|
|
| T |
24272288 |
ttgagctgaagacaaggcacgatacacctgacatcagtaacctgcaaaaatgtgctgattttgtccatgctttcatgttgggttttgatgtcattgatgc |
24272387 |
T |
 |
| Q |
108 |
tattgctcttctgcgtttagatgaactctatgttgagtcctttgagatcaaggatgttaagacacttcgtggcgatcacttgtctcgtgcaattggaaga |
207 |
Q |
| |
|
||||||| |||||||| | ||||| ||||||||||||||||||||||| |||||||||||||||||||| || ||||||||||| ||||| ||||||||| |
|
|
| T |
24272388 |
tattgctattctgcgtctggatgagctctatgttgagtcctttgagattaaggatgttaagacacttcgaggtgatcacttgtcccgtgctattggaaga |
24272487 |
T |
 |
| Q |
208 |
ttgtctggaaaa |
219 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
24272488 |
ttatctggaaaa |
24272499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University