View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11825_low_32 (Length: 247)
Name: NF11825_low_32
Description: NF11825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11825_low_32 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 13 - 247
Target Start/End: Complemental strand, 8378835 - 8378600
Alignment:
| Q |
13 |
agatggaataaattggtgatgtgatataaatagagataataagagaataatgtgttgaacaaatgtataaaattacaggttaataggctttcatccatgt |
112 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
8378835 |
agatgggataaattggtgatgtgatataaatagagataataagagaataatgtgttgaacaaatgtataaaattacgggttaataggctttcatccctgt |
8378736 |
T |
|
| Q |
113 |
catataggtcattttagttttccaccatgtaactt-ttttgttgttgagattcatccttgtaatttaaagnnnnnnnggttttggtccctcagtgcatat |
211 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8378735 |
catataggcgattttagttttccaccatgtaactttttttgttgttgagattcacccttgtaatttaaagtttatttggttttggtccctcagtgcatat |
8378636 |
T |
|
| Q |
212 |
gactgtacaaaaatttacgggttaataagattttac |
247 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8378635 |
gactgtacaaaaatttacgggttaataggattttac |
8378600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 238
Target Start/End: Complemental strand, 11429372 - 11429323
Alignment:
| Q |
189 |
ggttttggtccctcagtgcatatgactgtacaaaaatttacgggttaata |
238 |
Q |
| |
|
|||||||| |||||||||||||||||||| || ||||||| ||||||||| |
|
|
| T |
11429372 |
ggttttggaccctcagtgcatatgactgtgcagaaatttatgggttaata |
11429323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 199 - 247
Target Start/End: Complemental strand, 44051298 - 44051250
Alignment:
| Q |
199 |
cctcagtgcatatgactgtacaaaaatttacgggttaataagattttac |
247 |
Q |
| |
|
||||| ||||||||| ||| | |||||||||||||||||||| |||||| |
|
|
| T |
44051298 |
cctcaatgcatatgattgtgccaaaatttacgggttaataagcttttac |
44051250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 198 - 238
Target Start/End: Original strand, 40011448 - 40011488
Alignment:
| Q |
198 |
ccctcagtgcatatgactgtacaaaaatttacgggttaata |
238 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||| |
|
|
| T |
40011448 |
ccctcagtgcatatgactgtgcagaaatttatgggttaata |
40011488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University