View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11825_low_40 (Length: 224)
Name: NF11825_low_40
Description: NF11825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11825_low_40 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 12 - 207
Target Start/End: Complemental strand, 26458343 - 26458148
Alignment:
| Q |
12 |
cagagaaagataaggaagaacacaagagtagtcagatgcatactgagtcaaattgtcaactgatttccagcaaaaatgtatataaattataaataaataa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
26458343 |
cagagaaagataaggaagaacacaagagtggtcagatgcatactgagtcaaattgtcaactgatttccagcaaaaatgtatataaattataaataaagaa |
26458244 |
T |
|
| Q |
112 |
agtcgtatgttatctacaatagtgatagttattgcacacttttatgttgattgataaaattaatgcaaggtgttcgaagagtaaatccgatttaaa |
207 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26458243 |
agtcggatgttatctacaatagtgatagttattgcacacttttatgttgattgataaaattaatgcaaagtgttcgaagagtaaatccgatttaaa |
26458148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University