View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11826_high_39 (Length: 292)

Name: NF11826_high_39
Description: NF11826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11826_high_39
NF11826_high_39
[»] chr6 (1 HSPs)
chr6 (18-205)||(6033795-6033974)


Alignment Details
Target: chr6 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 18 - 205
Target Start/End: Original strand, 6033795 - 6033974
Alignment:
18 tggttgaaatggtcacgtcaaagatcacttataatcgatatgtgcgaacaccagacacattttaactnnnnnnnnnggatgattttaaagacttcttaca 117  Q
    |||||||| ||||||||| |||||||||||||| || |||| |||||||||||| ||||||||||             | ||||||||||||||||||||    
6033795 tggttgaattggtcacgttaaagatcacttatagtcaatatatgcgaacaccag-cacattttaaaaaaa--------aagattttaaagacttcttaca 6033885  T
118 attcttatgaccatccgccatatgtgcaagagttt-gaagggttcttaggattaaaattttgacttgttaatttttcattgatttttgc 205  Q
    ||||| ||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
6033886 attctgatgaccatcggccatatgtgcaagagttttgaagggttcttaggattaaaattttgacttgttaatttttcattgatttttgc 6033974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University