View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11826_high_40 (Length: 291)

Name: NF11826_high_40
Description: NF11826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11826_high_40
NF11826_high_40
[»] chr5 (1 HSPs)
chr5 (115-219)||(22687617-22687721)


Alignment Details
Target: chr5 (Bit Score: 89; Significance: 6e-43; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 115 - 219
Target Start/End: Complemental strand, 22687721 - 22687617
Alignment:
115 ttttctgaacaagatctacgtgattccgtcctagggtggagacatctatgttgttgtgtttttccctgttgtggtggttgtttcgtggctgcatgtacct 214  Q
    |||||||||| |||||||||||||||||||||||||| ||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||    
22687721 ttttctgaactagatctacgtgattccgtcctagggtagagacatctatattgttgtgtttctccctgttgtggtggttgtttcgtggctgcatgtacct 22687622  T
215 tgccg 219  Q
    |||||    
22687621 tgccg 22687617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University