View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11826_high_40 (Length: 291)
Name: NF11826_high_40
Description: NF11826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11826_high_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 89; Significance: 6e-43; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 115 - 219
Target Start/End: Complemental strand, 22687721 - 22687617
Alignment:
| Q |
115 |
ttttctgaacaagatctacgtgattccgtcctagggtggagacatctatgttgttgtgtttttccctgttgtggtggttgtttcgtggctgcatgtacct |
214 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| ||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22687721 |
ttttctgaactagatctacgtgattccgtcctagggtagagacatctatattgttgtgtttctccctgttgtggtggttgtttcgtggctgcatgtacct |
22687622 |
T |
 |
| Q |
215 |
tgccg |
219 |
Q |
| |
|
||||| |
|
|
| T |
22687621 |
tgccg |
22687617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University