View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11826_high_45 (Length: 274)
Name: NF11826_high_45
Description: NF11826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11826_high_45 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 19 - 261
Target Start/End: Original strand, 38357880 - 38358122
Alignment:
| Q |
19 |
atggaggcttgtagacactaccagttgtattgagccctaccccttgatggaacaactcaagaacttttggtgtcattgcattggaaaaattttccataat |
118 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38357880 |
atggaggattgtagacactaccagttgtattgagccctaccccttgatggaacaactcaagaacttttggtgtcattgcattggaaaaattttctataat |
38357979 |
T |
|
| Q |
119 |
attttcaggaccaagacaaaacttggtcaccctcatttgattcaatgtcaaggtacctgttttatcagtgcagataactgttgctgatcccatagtttca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38357980 |
attttcaggaccaagacaaaacttggtcaccctcatttgattcaatgtcaaggtacctgttttatcagtgcagataactgttgctgatcccatagtttca |
38358079 |
T |
|
| Q |
219 |
caagctgaaagtttcctcaccatagcatgatctgccatcattc |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38358080 |
caagctgaaagtttcctcaccatagcatgatctgccatcattc |
38358122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 171 - 260
Target Start/End: Original strand, 4243361 - 4243450
Alignment:
| Q |
171 |
gtacctgttttatcagtgcagataactgttgctgatcccatagtttcacaagctgaaagtttcctcaccatagcatgatctgccatcatt |
260 |
Q |
| |
|
|||||||| ||||||||||| ||| || |||||||||||||||||||| || |||||||| |||||||| || ||||| ||||||||| |
|
|
| T |
4243361 |
gtacctgtcttatcagtgcaaatagtagtagctgatcccatagtttcacatgcagaaagttttctcaccattgcttgatcagccatcatt |
4243450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 197 - 225
Target Start/End: Original strand, 39951612 - 39951640
Alignment:
| Q |
197 |
tgttgctgatcccatagtttcacaagctg |
225 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39951612 |
tgttgctgatcccatagtttcacaagctg |
39951640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University