View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11826_high_49 (Length: 250)
Name: NF11826_high_49
Description: NF11826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11826_high_49 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 48691709 - 48691467
Alignment:
| Q |
1 |
catgcatggttggttgatggttatctatatacctaccgagtccaggtattacctaccacctaggtgactgagggagggagctctgctcaaatctatacta |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
48691709 |
catgcatggttggttgatggttgtctatatacctaccgagtccaggtattacctaccacctaggtaactgagggagggagctctgctcaaatctatacta |
48691610 |
T |
|
| Q |
101 |
tcggcttaatattgaaaaata-----tattgtttannnnnnnngacagaaaatatatatataggtaaaagttaaagaaaataatgtcatattttagtgga |
195 |
Q |
| |
|
|| |||||||||||||||||| ||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48691609 |
tcagcttaatattgaaaaatatactgtattgtttattttttttgacagaaa----atatataggtaaaagttaaagaaaataatgtcatattttagtgga |
48691514 |
T |
|
| Q |
196 |
aaacaccaccccggtttttcttgcacaaaatagttaaccttcatctc |
242 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48691513 |
aaacaccactccggtttttcttgcacaaaatagttaaccttcatctc |
48691467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University