View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11826_high_51 (Length: 232)
Name: NF11826_high_51
Description: NF11826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11826_high_51 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 6753032 - 6753129
Alignment:
| Q |
1 |
gattgtgcaatttctgaagctcgtggacactctggagggatatggatattaaaatctcaaaattgcacatatgatattgagattatagataactattt |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6753032 |
gattgtgcaatttctgaagctcgtggacactctggagggatatggatattaaaatctcaaaattgcacatatgatattgagattatagataactattt |
6753129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 2 - 98
Target Start/End: Complemental strand, 1811501 - 1811405
Alignment:
| Q |
2 |
attgtgcaatttctgaagctcgtggacactctggagggatatggatattaaaatctcaaaattgcacatatgatattgagattatagataactattt |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1811501 |
attgtgcaatttctgaagctcgtggacactctggaggtatatggatattaaaatctcaaaattgcacatatgatattgagattatagataactattt |
1811405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 148 - 209
Target Start/End: Complemental strand, 1028341 - 1028280
Alignment:
| Q |
148 |
tctgttctgtcctatctattatgcaagtcgtaccggattcaatggtggtgatggtgatgata |
209 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1028341 |
tctgttctgtcctatctattatgcaagttgtaccggattcaatggtggtgatggtgatgata |
1028280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University