View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11826_low_41 (Length: 292)
Name: NF11826_low_41
Description: NF11826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11826_low_41 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 18 - 205
Target Start/End: Original strand, 6033795 - 6033974
Alignment:
| Q |
18 |
tggttgaaatggtcacgtcaaagatcacttataatcgatatgtgcgaacaccagacacattttaactnnnnnnnnnggatgattttaaagacttcttaca |
117 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||| || |||| |||||||||||| |||||||||| | |||||||||||||||||||| |
|
|
| T |
6033795 |
tggttgaattggtcacgttaaagatcacttatagtcaatatatgcgaacaccag-cacattttaaaaaaa--------aagattttaaagacttcttaca |
6033885 |
T |
|
| Q |
118 |
attcttatgaccatccgccatatgtgcaagagttt-gaagggttcttaggattaaaattttgacttgttaatttttcattgatttttgc |
205 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6033886 |
attctgatgaccatcggccatatgtgcaagagttttgaagggttcttaggattaaaattttgacttgttaatttttcattgatttttgc |
6033974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University