View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11826_low_49 (Length: 263)
Name: NF11826_low_49
Description: NF11826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11826_low_49 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 15 - 157
Target Start/End: Complemental strand, 30217685 - 30217543
Alignment:
| Q |
15 |
gacacagttctagaaatgctagtttgtgtcatctaaataaacataccagcacacataacaatagttagttaggatccaactagtgtaacaacaaaatgta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30217685 |
gacacagttctagaaatgctagtttgtgtcatctaaataaacataccagcacacataacaatagttagttaggatccaactagtgtaacaacaaaatgta |
30217586 |
T |
|
| Q |
115 |
ctaacaagagttaaaatgcaaaataagcataatacaaaaagag |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30217585 |
ctaacaagagttaaaatgcaaaataagcataatacaaaaagag |
30217543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University