View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11826_low_56 (Length: 231)
Name: NF11826_low_56
Description: NF11826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11826_low_56 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 39983527 - 39983735
Alignment:
| Q |
1 |
caatcttcagcagctctacgtggaaccgaaaaccctccatgagtgctggtatcagaggcagtgagtgttttgcaaaacatgtgagaagctagctttgtag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39983527 |
caatcttcagcagctctacgtggaaccgaaaaccctccatgagtgctggtatcagaggcagtgagtgttttgcaaaacatgtgagaagctaactttgtag |
39983626 |
T |
 |
| Q |
101 |
gggatcttccatttccctcatcatctgcttccaaaccttcaggctctttgtcatccaaacacatccctgctaactgaatgcaacacatgatttatagtta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39983627 |
gggatcttccatttccctcatcatctgcttccaaaccttcaggctctttgtcatccaaacacatccctgctaactgaatgcaacacatgatttatagtta |
39983726 |
T |
 |
| Q |
201 |
ccttatgag |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
39983727 |
ccttatgag |
39983735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 22235958 - 22235874
Alignment:
| Q |
1 |
caatcttcagcagctctacgtggaaccgaaaaccctccatgagtgctggtatcagaggcagtgagtgttttgcaaaacatgtgag |
85 |
Q |
| |
|
|||||||||||||||||||| || || || || || ||||||||||||||||||||| |||| ||||| ||||| |||||||||| |
|
|
| T |
22235958 |
caatcttcagcagctctacgaggcacagagaatccaccatgagtgctggtatcagagacagttagtgtcttgcagaacatgtgag |
22235874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University