View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11826_low_60 (Length: 221)
Name: NF11826_low_60
Description: NF11826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11826_low_60 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 16 - 201
Target Start/End: Original strand, 31856750 - 31856936
Alignment:
| Q |
16 |
ataggtagatttgaatatgcatat-aggagttcaactaccttgactactcaacaattctattgatatagtcttgttttgttacttgcccaagtttgatag |
114 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31856750 |
ataggtagatttgaatatgcatattaggagttcaactaccttgactactcaacaattctattgatatagtcttgttttgttacttgcccaagtttgatag |
31856849 |
T |
 |
| Q |
115 |
tttggtaggttaggctagaatgaagctgtaattacaaaccaaattttgaaatgactccatttagtcattgacgaattgaagcatata |
201 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31856850 |
tttggtaggttaggctagaatgaagctgtgattataaaccaaattttgaaatgactacatttagtcattgacgaattgaagcatata |
31856936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University