View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11827_high_14 (Length: 498)
Name: NF11827_high_14
Description: NF11827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11827_high_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 351; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 351; E-Value: 0
Query Start/End: Original strand, 20 - 393
Target Start/End: Complemental strand, 34691449 - 34691073
Alignment:
| Q |
20 |
ggtggaggagttgatggtttatgagaagggatgctacggatccaaggtatgataatatgaaattactacatgattcttgcatagataatgtgaaggtcat |
119 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34691449 |
ggtggaggagttgatggtttgtgagaagggatgctacggatccaaggtatgataatatgaaattactacatgattcttgcatagataatgtgaaggtcat |
34691350 |
T |
|
| Q |
120 |
acaattacgttgatatgaaattagtacatgattcttgcaactctttataatattgatcctataaatagaggttttatgacacttgagatatatagacaat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34691349 |
acaattacgttgatatgaaattagtacatgattcttgcaactctttataatattgatcctataaatagaggtttcatgacacttgagatatatagacaat |
34691250 |
T |
|
| Q |
220 |
aattgaatgatgtagtgatatctagttggttattctcttgagttttctctagatctttcatctcttggttcttctccacccctttaagttccttaaactt |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34691249 |
aattgaatgatgtagtgatatctagttggttattctcttgagttttctctagatctttcatctcttggttcttctccacccctttaagttccttaaactt |
34691150 |
T |
|
| Q |
320 |
tggttttca---cttttctaaatttcgtctattttcttaatatgtatctctagggatttaattgagataatcaaata |
393 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34691149 |
tggttttcacttcttttctaaatttcatctattttcttaatatgtatctctagggatttaattgagataatcaaata |
34691073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University