View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11827_high_21 (Length: 424)

Name: NF11827_high_21
Description: NF11827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11827_high_21
NF11827_high_21
[»] chr4 (3 HSPs)
chr4 (2-68)||(37571314-37571380)
chr4 (320-381)||(37571632-37571693)
chr4 (219-267)||(37571531-37571579)


Alignment Details
Target: chr4 (Bit Score: 67; Significance: 1e-29; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 2 - 68
Target Start/End: Original strand, 37571314 - 37571380
Alignment:
2 atgaaggagaggacaacgagacggaggtgaggatcggaggagaggaaagtgtcgtaaagccagtgac 68  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37571314 atgaaggagaggacaacgagacggaggtgaggatcggaggagaggaaagtgtcgtaaagccagtgac 37571380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 320 - 381
Target Start/End: Original strand, 37571632 - 37571693
Alignment:
320 acggaggaggaggatgagttggagttggaggaacattgtggtgatgatgaattgttgttgtt 381  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37571632 acggaggaggaggatgagttggagttggaggaacattgtggtgatgatgaattgttgttgtt 37571693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 219 - 267
Target Start/End: Original strand, 37571531 - 37571579
Alignment:
219 ttcgggaacgggctttggaaactgattcccaccatgagtgcattggatc 267  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||    
37571531 ttcgggaacgggctttggaaactgattcccaccaagagtgcattggatc 37571579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University