View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11827_high_36 (Length: 306)
Name: NF11827_high_36
Description: NF11827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11827_high_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 15 - 288
Target Start/End: Original strand, 8584891 - 8585164
Alignment:
| Q |
15 |
atgaacttgatgtcttcgtttgtctctggaatatcacgtcgttgaagcaacttcaactctcttgcctttgtttcttccaattctttctttgtttgctcaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8584891 |
atgaacttgatgtcttcgtttgtctctggaatatcacgtcgttgaagcaacttccactctcttgcctttgtttcttccaattctttctttgtttgctcaa |
8584990 |
T |
 |
| Q |
115 |
gttctttcttgagggatttgatgcattgtgctaagaagttagcttcttcttttgatccttcaagtttttgctttgtttcttctagctcagctgctaatgc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8584991 |
gttctttcttgagggatttgatgcattgtgctaagaagttagcttcttcttttgatccttcaagtttttgctttgtttcttctagctcagctgctaatgc |
8585090 |
T |
 |
| Q |
215 |
tccagctttggattgtgcatgaccagtctcgcttgcttcattttgcatcttaatcatttcacatgcataatcat |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8585091 |
tccagctttggattgtgcatgaccagtctcgcttgcttcattttgcatcttaatcatttcacatgcataatcat |
8585164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University