View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11827_high_45 (Length: 273)
Name: NF11827_high_45
Description: NF11827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11827_high_45 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 19 - 273
Target Start/End: Original strand, 38440949 - 38441203
Alignment:
| Q |
19 |
aaattgcctatcggagccaaaggagttcgttatttagaccataaatggtgtgttttgagtaaagaggtaaagaacttgagttcagtttatggaccattgg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38440949 |
aaattgcctatcggagccaaaggagttcgttatttagaccataaatggtgtgttttgagtaaagaggtaaagaacttgagttcggtttatggaccattgg |
38441048 |
T |
 |
| Q |
119 |
gttacgcttgtgcagttggtgattgtacaagcttatgtattggttgttcttgtggaaatttggatgtgcgtggtaatacttcacatgcttacaatcaata |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38441049 |
gttacgcttgtgcagttggtgattgtacaagcttatgtattggttgttcttgtggaaatttggatgtgcgtggtaatacttcatatgcttacaatcaata |
38441148 |
T |
 |
| Q |
219 |
ctttcaaatgaacgaacaaagtgtggaggcatgtaattttgatggaactgccact |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38441149 |
ctttcaaatgaacgaacaaagtgtggaggcatgtagttttgatggaactgccact |
38441203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University