View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11827_high_49 (Length: 237)
Name: NF11827_high_49
Description: NF11827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11827_high_49 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 15750422 - 15750191
Alignment:
| Q |
1 |
cagatttggattgagcggaacaatcgatattttcaaaataaggagttaccaatgtttaggctgatccagaatgttgtgcttgaagtgaaattaagctctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
15750422 |
cagatttggattgagcggaacaatcgatattttcaaaataaggagttaccaatgtttaggctgatccagaatgttgtgcatgaagtgaaattaagctctt |
15750323 |
T |
 |
| Q |
101 |
cggtgatggctgggtgcaactctaccgcaaccctggattttcaaattagtgctctctttgagctttcatctagaccccccaggcaggttccttccttccc |
200 |
Q |
| |
|
| ||||||||||||| || |||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |||| ||| |||||||||||||||| |
|
|
| T |
15750322 |
ctgtgatggctgggtccagctctaccgcaactctggatttgcaaattagtgctctctttgagctttcatctagaacccctaggtaggttccttccttccc |
15750223 |
T |
 |
| Q |
201 |
ctctgaggtgtgttggtttgctccgcgtatag |
232 |
Q |
| |
|
||| ||||||||||||||||||||| |||||| |
|
|
| T |
15750222 |
ctccgaggtgtgttggtttgctccgtgtatag |
15750191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University