View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11827_high_54 (Length: 214)
Name: NF11827_high_54
Description: NF11827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11827_high_54 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 44850677 - 44850474
Alignment:
| Q |
1 |
ttctatgagtaattgtccttatatcaagacatggcttcaatttagcatatatattaactgtgtatttgaaacagtttgttttgtatttttctgacccagc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44850677 |
ttctatgagtaattgtccttatatcaagacatggcttcaatttagcatatatattaactgtgtatttgaaacagtttgtttcgtatttttctgacccagc |
44850578 |
T |
 |
| Q |
101 |
ttgtattagtattgtgtataagctgaatgaatcagtttgttttgtatt---tgagtcacattaagaaacttctttggattcccttgccacttggaccaca |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44850577 |
ttgtattagtattgtgtataagctgaatgaatcagtttgttttgtatttgatgagtcacattaagaaacttctttggattcccttgccacttggaccaca |
44850478 |
T |
 |
| Q |
198 |
ggtt |
201 |
Q |
| |
|
|||| |
|
|
| T |
44850477 |
ggtt |
44850474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University