View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11827_low_23 (Length: 424)
Name: NF11827_low_23
Description: NF11827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11827_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 67; Significance: 1e-29; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 2 - 68
Target Start/End: Original strand, 37571314 - 37571380
Alignment:
| Q |
2 |
atgaaggagaggacaacgagacggaggtgaggatcggaggagaggaaagtgtcgtaaagccagtgac |
68 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37571314 |
atgaaggagaggacaacgagacggaggtgaggatcggaggagaggaaagtgtcgtaaagccagtgac |
37571380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 320 - 381
Target Start/End: Original strand, 37571632 - 37571693
Alignment:
| Q |
320 |
acggaggaggaggatgagttggagttggaggaacattgtggtgatgatgaattgttgttgtt |
381 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37571632 |
acggaggaggaggatgagttggagttggaggaacattgtggtgatgatgaattgttgttgtt |
37571693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 219 - 267
Target Start/End: Original strand, 37571531 - 37571579
Alignment:
| Q |
219 |
ttcgggaacgggctttggaaactgattcccaccatgagtgcattggatc |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37571531 |
ttcgggaacgggctttggaaactgattcccaccaagagtgcattggatc |
37571579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University