View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11827_low_39 (Length: 306)

Name: NF11827_low_39
Description: NF11827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11827_low_39
NF11827_low_39
[»] chr5 (1 HSPs)
chr5 (15-288)||(8584891-8585164)


Alignment Details
Target: chr5 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 15 - 288
Target Start/End: Original strand, 8584891 - 8585164
Alignment:
15 atgaacttgatgtcttcgtttgtctctggaatatcacgtcgttgaagcaacttcaactctcttgcctttgtttcttccaattctttctttgtttgctcaa 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
8584891 atgaacttgatgtcttcgtttgtctctggaatatcacgtcgttgaagcaacttccactctcttgcctttgtttcttccaattctttctttgtttgctcaa 8584990  T
115 gttctttcttgagggatttgatgcattgtgctaagaagttagcttcttcttttgatccttcaagtttttgctttgtttcttctagctcagctgctaatgc 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8584991 gttctttcttgagggatttgatgcattgtgctaagaagttagcttcttcttttgatccttcaagtttttgctttgtttcttctagctcagctgctaatgc 8585090  T
215 tccagctttggattgtgcatgaccagtctcgcttgcttcattttgcatcttaatcatttcacatgcataatcat 288  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8585091 tccagctttggattgtgcatgaccagtctcgcttgcttcattttgcatcttaatcatttcacatgcataatcat 8585164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University