View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11827_low_45 (Length: 286)
Name: NF11827_low_45
Description: NF11827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11827_low_45 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 254; Significance: 1e-141; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 11 - 268
Target Start/End: Original strand, 43222230 - 43222487
Alignment:
| Q |
11 |
cacagacaattttagtactgattaaggaattcgctcacctgatcataatttagaacttcttctgattgatgatcaacagctgcaagtgtgcctacaggtt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43222230 |
cacagacaattttagtactgattaaggaattcgctcacctgatcataatttagaacttcttctgattgatgatcaacagctgcaagtgtgcctacaggtt |
43222329 |
T |
|
| Q |
111 |
tgccattgaaatagactagagacttcctgagagattcccaggcatcagcaagcattggctgaggctcgaacgagttctgagcagatgaaagtgatcttgc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43222330 |
tgccattgaaatagactagagacttcctgagagattcccaggcatcagcaagcattggctgaggctcgaacgagttctgagcagatgaaaatgatcttgc |
43222429 |
T |
|
| Q |
211 |
tccaatggacagttcactgagtaaactgtcatcaactgatctctgtctctctatgttt |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43222430 |
tccaatggacagttcactgagtaaactgtcatcaactgatctctgtctctctatgttt |
43222487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 18 - 199
Target Start/End: Original strand, 43232654 - 43232831
Alignment:
| Q |
18 |
aattttagtactgattaaggaattcgctcacctgatcataatttagaacttcttctgattgatgatcaacagctgcaagtgtgcctacaggtttgccatt |
117 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||| |||| |||||||||||||||||||| |||||| |||||| || | |
|
|
| T |
43232654 |
aattttagtactgattaagaaattc----acctgatcgtaatttagaacttcctctgcttgatgatcaacagctgcaattgtgccaacaggtgcacctct |
43232749 |
T |
|
| Q |
118 |
gaaatagactagagacttcctgagagattcccaggcatcagcaagcattggctgaggctcgaacgagttctgagcagatgaa |
199 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||||||| |||||| || ||||| |||||||| ||||||||||| |
|
|
| T |
43232750 |
gaaatggactagagatttcctgagagattcccaggcatcagcaaccattggatgcggctcaaacgagttgcgagcagatgaa |
43232831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University