View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11827_low_47 (Length: 283)
Name: NF11827_low_47
Description: NF11827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11827_low_47 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 4342462 - 4342681
Alignment:
| Q |
18 |
acctggaactgttgtgaaaaattgcgaaccttaacagttgctcttaatttttaaacaattcaatataggaagcaagggatcaactcgtaattttttccca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4342462 |
acctggaactgttgtgaaaaattgcgaaccttaacagttgctcctaatttttaaacaattcaatataggaagcaagggatcaactcgtaatttt-tccca |
4342560 |
T |
|
| Q |
118 |
gcaccttcgatcagatcatgaacttttgggataagtgtactctatgtgagtgctgagaattgtatcaacgtgttattagaaatatgcagtaattttatgg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4342561 |
gcaccttcgatcagatcatgaacttttgggataagtgtactctatgtgagtgctgagaattgtatcaacgtgttattagaaatatgcagtaattttattt |
4342660 |
T |
|
| Q |
218 |
cattgtttagttctattgtag |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
4342661 |
cattgtttagttctattgtag |
4342681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University