View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11827_low_49 (Length: 256)
Name: NF11827_low_49
Description: NF11827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11827_low_49 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 7 - 132
Target Start/End: Complemental strand, 36290937 - 36290812
Alignment:
| Q |
7 |
tgtatttgaagagttattatactattcggctttacctaacatcccaaagctgtcnnnnnnnngacggaagggacggacatatgtattggaatgttggagc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36290937 |
tgtatttgaagagttattatactattcggctttacctaacatcccaaagctgtcttttttttgacggaagggacggacatatgtattggaatgttggagc |
36290838 |
T |
|
| Q |
107 |
atatgcttacactgtgttttgagaag |
132 |
Q |
| |
|
||||||||||||||| |||||||||| |
|
|
| T |
36290837 |
atatgcttacactgtcttttgagaag |
36290812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University