View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11827_low_49 (Length: 256)

Name: NF11827_low_49
Description: NF11827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11827_low_49
NF11827_low_49
[»] chr1 (1 HSPs)
chr1 (7-132)||(36290812-36290937)


Alignment Details
Target: chr1 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 7 - 132
Target Start/End: Complemental strand, 36290937 - 36290812
Alignment:
7 tgtatttgaagagttattatactattcggctttacctaacatcccaaagctgtcnnnnnnnngacggaagggacggacatatgtattggaatgttggagc 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||    
36290937 tgtatttgaagagttattatactattcggctttacctaacatcccaaagctgtcttttttttgacggaagggacggacatatgtattggaatgttggagc 36290838  T
107 atatgcttacactgtgttttgagaag 132  Q
    ||||||||||||||| ||||||||||    
36290837 atatgcttacactgtcttttgagaag 36290812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University