View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11828_high_29 (Length: 257)
Name: NF11828_high_29
Description: NF11828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11828_high_29 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 19 - 257
Target Start/End: Original strand, 46314543 - 46314781
Alignment:
| Q |
19 |
acacatcactcttcgcgctaagatcctccggtgcaagatagcatggatcaagataccctaacgtacccgccggtggtgtgcactttacacgaacgtcttc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46314543 |
acacatcactcttcgcgctaagatcctccggtgcaagatagcatggatcaagataccctaacgtacccgccggtggtgtgcactttacacgaacgtcttc |
46314642 |
T |
|
| Q |
119 |
cacgtgtcctcttagcgctaaaccgaaatcaccgagtctcgctttgaaatcttgatcgatcaaaacgttggaggatttaatatcacggtgaataaccgga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46314643 |
cacgtgtcctcttagcgctaaaccgaaatcaccgagtctcgctttgaaatcttgatcgatcaaaacgttggaggatttaatatcacggtgaataaccgga |
46314742 |
T |
|
| Q |
219 |
ggatttgaaccgtgtaaagttcgaaccgcttttgcaact |
257 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46314743 |
ggatttgaaccgtgtaaggttcgaaccgcttttgcaact |
46314781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University