View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11828_low_15 (Length: 376)
Name: NF11828_low_15
Description: NF11828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11828_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 7 - 152
Target Start/End: Original strand, 36276476 - 36276621
Alignment:
| Q |
7 |
gtctagttggaaaaacaactttaatgatcaagttaccatgttcctctaaaaaatggccaggttactatgtccaagggagatgtgctcataatgtcttcca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36276476 |
gtctagttggaaaaacaactttaatgatcaagttaccatgttcctctaaaaaatggccaggttactatgtccaagggagatgtgctcataatgtcttcca |
36276575 |
T |
|
| Q |
107 |
ttcttattgagaagttattaaaactttggaagtcatttcgtgatgg |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36276576 |
ttcttattgagaagttattaaaactttggaagtcatttggtgatgg |
36276621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 266 - 354
Target Start/End: Original strand, 36276627 - 36276715
Alignment:
| Q |
266 |
attcacaatcttccacgggaatattggagattaaatattattttcacaattacttatggccaatttcaaaatcatgagtcactttgctg |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36276627 |
attcacaatcttccacgggaatattggagattaaatattattttcacaagtacttatggccaatttcaaaatcatgagtcactttgctg |
36276715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University