View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11828_low_20 (Length: 332)
Name: NF11828_low_20
Description: NF11828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11828_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 105 - 321
Target Start/End: Original strand, 44695167 - 44695383
Alignment:
| Q |
105 |
caagtgcatctaatgcttgtgagattgcagtggttgaaggttcagttgaaggaagcaacgggagcgttgatactctgaacatgatggacactgatgttgg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44695167 |
caagtgcatctaatgcttgtgagattgcagtggttgaaggttcagttgaaggaagcaacgggagcgttgatactgtgaacatgatggacactgatgttgg |
44695266 |
T |
|
| Q |
205 |
ctgtttgatagcaactaccaattcaatgacagcagttgttgccgcaaatgaggaagtaaaacaatcttttgaagatgatttaaactcaacaagttcttca |
304 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44695267 |
ctgtttgatggcaactaccaattcaatgacagcagttgttgccgcaaatgaggaagtaaaacaatcttttgcagatgatttaaactcaacaagttcttca |
44695366 |
T |
|
| Q |
305 |
ccctgtgaatggttcat |
321 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
44695367 |
ccctgtgaatggttcat |
44695383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 208 - 323
Target Start/End: Complemental strand, 39146597 - 39146482
Alignment:
| Q |
208 |
tttgatagcaactaccaattcaatgacagcagttgttgccgcaaatgaggaagtaaaacaatcttttgaagatgatttaaactcaacaagttcttcaccc |
307 |
Q |
| |
|
|||||| || ||||| ||||| |||||||||| ||||| ||||| |||||||||||||| || ||| ||||||| |||||||||| ||| ||||| |
|
|
| T |
39146597 |
tttgatggcgactactgattcagtgacagcagtggttgcggcaaaggaggaagtaaaacaggctgttgcagatgatctaaactcaactcattcatcacct |
39146498 |
T |
|
| Q |
308 |
tgtgaatggttcatct |
323 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
39146497 |
tgtgaatggttcatct |
39146482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University