View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11828_low_22 (Length: 317)
Name: NF11828_low_22
Description: NF11828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11828_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 25 - 305
Target Start/End: Original strand, 52807517 - 52807797
Alignment:
| Q |
25 |
ttctaatcatgatcataattgtttccatgttatattgactttgaaacataggttcttcaactgtttggttattccatgcaaagtttctatggctttctct |
124 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52807517 |
ttctaatcatgatcataattgtttccatgctatattgactttgaaacataggttcttgaactgtttggttattccatgcaaagtttctatggctttctct |
52807616 |
T |
 |
| Q |
125 |
gcttctgagcttaatggtggcgctgtcgtaagccatggcagcatctctttcagatttgaatgtccctaaccatattctttggtgatttgcatatatttgt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52807617 |
gcttctgagcttaatggtggcgctgtcgtaagccatggcagcatctctttcagatttgaatgtccctaaccatattctttggtgatttgcatatatttgt |
52807716 |
T |
 |
| Q |
225 |
gcaccccaatgtccattttgttgaggcacaacccctttcaacttttcacaccctgcaacatcctctacttcatacctccta |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52807717 |
gcaccccaatgtccattttgttgaggcacaacccctttcaacttttcacaccctgcaacatcctctacttcatacctccta |
52807797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University