View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11828_low_23 (Length: 300)
Name: NF11828_low_23
Description: NF11828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11828_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 257; Significance: 1e-143; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 289
Target Start/End: Complemental strand, 19291820 - 19291532
Alignment:
| Q |
1 |
gcaaaacttaacttttaacgagcctctgcccttggaaataggacacctaatattgaccatgttatcttcaagcttggaaccgatgtatttcgccatggaa |
100 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
19291820 |
gcaaaactttgcttttaacgagcctctgcacttggaaataggacaccgaatattgaccatgttatcttcaagcttggaaccgatgtatttcgccatgcaa |
19291721 |
T |
 |
| Q |
101 |
tcagaggaatatgcgtgagagctgccaccgatatagatagcgcccttcattgttttagtatgggggcaaattttgcacactcaactttttcgattttgtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19291720 |
tcagaggaatatgcgtgagagctgccaccgatatagaaagcacccttcattgttttagtatgggggcaaattttgcacactcaactttttcgattttgtt |
19291621 |
T |
 |
| Q |
201 |
tcttgtagggtttccagaagggatagtttagggaatgaaattgatggttctaatggcatgtcttcgcagtcatcagaaaggtggttcat |
289 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19291620 |
tcttgtagggtttccagaagggatggtttagggaatgaaattgatggttctaatggcatgtcttcgcagtcatcagaaaggtggttcat |
19291532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 40 - 159
Target Start/End: Complemental strand, 19270450 - 19270331
Alignment:
| Q |
40 |
aggacacctaatattgaccatgttatcttcaagcttggaaccgatgtatttcgccatggaatcagaggaatatgcgtgagagctgccaccgatatagata |
139 |
Q |
| |
|
|||||||| |||||| || |||||||||||||| |||||||| |||||| |||| |||| ||| |||| || ||||||| || | ||| || ||| |
|
|
| T |
19270450 |
aggacaccgaatattaacgatgttatcttcaagtttggaacctatgtatgatgccacacaatccgagcaataagcatgagagcaaccgctgatgtaaata |
19270351 |
T |
 |
| Q |
140 |
gcgcccttcattgttttagt |
159 |
Q |
| |
|
||| |||||||||||||||| |
|
|
| T |
19270350 |
gcgtccttcattgttttagt |
19270331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 40 - 159
Target Start/End: Complemental strand, 19314738 - 19314619
Alignment:
| Q |
40 |
aggacacctaatattgaccatgttatcttcaagcttggaaccgatgtatttcgccatggaatcagaggaatatgcgtgagagctgccaccgatatagata |
139 |
Q |
| |
|
||||||| ||| ||||| ||||| ||||||||||||||||| ||||| | |||| | |||||||| ||||| ||||||| | || | ||| |||| | |
|
|
| T |
19314738 |
aggacactgaattttgacgatgttttcttcaagcttggaaccaatgtacatggccacgcaatcagagcaatatacgtgagaacaaccgctgatgtagaaa |
19314639 |
T |
 |
| Q |
140 |
gcgcccttcattgttttagt |
159 |
Q |
| |
|
|| |||||||||||||||| |
|
|
| T |
19314638 |
gcatccttcattgttttagt |
19314619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University