View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11828_low_26 (Length: 285)
Name: NF11828_low_26
Description: NF11828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11828_low_26 |
 | |
|
| [»] scaffold0141 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0141 (Bit Score: 146; Significance: 6e-77; HSPs: 1)
Name: scaffold0141
Description:
Target: scaffold0141; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 9 - 154
Target Start/End: Original strand, 6184 - 6329
Alignment:
| Q |
9 |
agcagagattagattcttattcttctctttgctttggtaccagccttgatatctcaatcttgcaaggcacgacaggcatcggaacgaactccgcggagag |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6184 |
agcagagattagattcttattcttctctttgctttggtaccagccttgatatctcaatcttgcaaggcacgacaggcatcggaacgaactccgcggagag |
6283 |
T |
|
| Q |
109 |
ccactctttggtccaataaagagacagatcagcatccatagaatct |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6284 |
ccactctttggtccaataaagagacagatcagcatccatagaatct |
6329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 146; Significance: 6e-77; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 9 - 174
Target Start/End: Complemental strand, 49238086 - 49237921
Alignment:
| Q |
9 |
agcagagattagattcttattcttctctttgctttggtaccagccttgatatctcaatcttgcaaggcacgacaggcatcggaacgaactccgcggagag |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |||||||||||||||||||| |
|
|
| T |
49238086 |
agcagagattagattcttattcttctctttgctttggtaccagccttgatatctcaatcttgcaaggtacgacatgcattggaacgaactccgcggagag |
49237987 |
T |
|
| Q |
109 |
ccactctttggtccaataaagagacagatcagcatccatagaatctatctagaaagaggcagtctg |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
49237986 |
ccactctttggtccaataaagagacagatcatcatccatagaatctatctagaaataggcagtctg |
49237921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 220 - 285
Target Start/End: Original strand, 44285603 - 44285668
Alignment:
| Q |
220 |
ttcttaccggaagttacatttaagaatatatccattaaaggaagattggacaatggggatctttac |
285 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44285603 |
ttcttaccggaagttacattgaagaatatatccattaaaggaagattggccaatggggatctttac |
44285668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 220 - 285
Target Start/End: Complemental strand, 44070410 - 44070345
Alignment:
| Q |
220 |
ttcttaccggaagttacatttaagaatatatccattaaaggaagattggacaatggggatctttac |
285 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
44070410 |
ttcttaccagaagttacattgaagaatatatccattaaagcaagattggacaatggagatctttac |
44070345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University