View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11828_low_34 (Length: 241)
Name: NF11828_low_34
Description: NF11828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11828_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 2 - 225
Target Start/End: Original strand, 22073931 - 22074156
Alignment:
| Q |
2 |
agtagacacacatactttcttgccttctaacactaatttccttctctct-ttgaagttgactgttgttcttgttgcctaagttgaagaggatccatgaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
22073931 |
agtagacacacatactttcttgccttctaacactaatttccttctctttcttgaagttgactgttgttctttttgcctaagttgaagaggatccatgaca |
22074030 |
T |
 |
| Q |
101 |
tatgttagttttagaacttgtatttagttaataaaagtgatgagagag-nnnnnnnatgttgttctataaatgaagttaaccacgcttttggaagtgaaa |
199 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| | || |
|
|
| T |
22074031 |
taggttagttttagaacttgtatttagttaataaaagtgatgagagagttttttttatgtttttctataaatgaagttaaccacgcttttggaaggggaa |
22074130 |
T |
 |
| Q |
200 |
aagatatagtttgacattttcccatg |
225 |
Q |
| |
|
|||||||||||||||||||| ||||| |
|
|
| T |
22074131 |
aagatatagtttgacatttttccatg |
22074156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University