View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11828_low_35 (Length: 240)
Name: NF11828_low_35
Description: NF11828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11828_low_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 153
Target Start/End: Complemental strand, 48415052 - 48414905
Alignment:
| Q |
1 |
tacaaggaatttaaaccttgatgaataatcgtaacttagtatatttatatacaacctctgtatgtatggaactttgatttgattatatgataaactcgca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || |
|
|
| T |
48415052 |
tacaaggaatttaaaccttgatgaataatcgtaacttagtatatttatatacaacctctgtatgtatggaacttt-----gattatatgataaactcaca |
48414958 |
T |
|
| Q |
101 |
aaaaattgaaaacaattaatgttgccaaattcagactaaagtggaaaattaaa |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48414957 |
aaaaattgaaaacaattaatgttgccaaattcagacttaagtggaaaattaaa |
48414905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 148 - 187
Target Start/End: Complemental strand, 48414885 - 48414846
Alignment:
| Q |
148 |
attaaacaatctatcccatattacagcagaagataataac |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48414885 |
attaaacaatctatcccatattacagcagaagataataac |
48414846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University