View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11831_low_15 (Length: 344)
Name: NF11831_low_15
Description: NF11831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11831_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 6e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 110 - 326
Target Start/End: Complemental strand, 35645855 - 35645642
Alignment:
| Q |
110 |
aatttcataagggaaaatgttccttggtgggaagaccaacaagcacgagtgttgtgtgaatattctaaaaccgttagatagnnnnnnnnnnnnnnncctt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
35645855 |
aatttcataagggaaaatgttccttggtgggaagaccaacaagcacgagtgttgtgtgaatcgtctaaaaccgttagatag---tgttttttttttcctt |
35645759 |
T |
|
| Q |
210 |
tctattccttttcttgtattttcatgatatcacctagatgagaagaatgtgaannnnnnnngttataattcttgatttgttttattcttctcatccttat |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35645758 |
tctattccttttcttgtattttcatgatatcacctagatgagaagaatgtgaattttttttgttataattcttgatttgttttattcttctcatccttat |
35645659 |
T |
|
| Q |
310 |
ttgacggtgtatattgg |
326 |
Q |
| |
|
||||| ||||||||||| |
|
|
| T |
35645658 |
ttgacagtgtatattgg |
35645642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University