View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11831_low_20 (Length: 298)
Name: NF11831_low_20
Description: NF11831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11831_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 13 - 283
Target Start/End: Complemental strand, 26297893 - 26297623
Alignment:
| Q |
13 |
agaatcagtagaaaccaaatcaacaggattaccaacacaagctcttcttttagaaatagttttcaaaccagaaactcttggaacggaagaggaagcatcg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26297893 |
agaatcagtagaaaccaaatcaacaggattaccaacacaagctcttcttttagaaatagttttcaaaccagaaactcttggaacggaagaggaagcatcg |
26297794 |
T |
|
| Q |
113 |
ttatcaaagcgagtgacgtaaacgaactgaccgagctggagtttatcagaacggattaactcggcgtcggagtcggagacggagacataagcggagtgaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26297793 |
ttatcaaagcgagtgacgtaaacgaactgaccgagctggagtttatcagaacggattaactcggcgtcggagtcggagacggagacataagcggagtgaa |
26297694 |
T |
|
| Q |
213 |
gagagtcggagagtttgagaaagtagccggtggcgggttgaaatgtgtcttctgaaagacgagggatgatt |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26297693 |
gagagtcggagagtttgagaaagtagccggtggcgggttgaaatgtgtcttctgaaagacgagggatgatt |
26297623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University