View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11831_low_26 (Length: 242)
Name: NF11831_low_26
Description: NF11831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11831_low_26 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 19 - 242
Target Start/End: Original strand, 25320976 - 25321200
Alignment:
| Q |
19 |
tatttcaccctagaccaatcatccaacgatgaattactagatgttttttggcctgaaaaacccaaagacataccatacatatgagaaataggaaggttga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| || |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
25320976 |
tatttcaccctagaccaatcatccaacgatgaattactaaatgttttttggcctgaaaatcc-aaagacataccatacaaatgagaaataggaaggttga |
25321074 |
T |
 |
| Q |
119 |
attgaataattatcataaatttgaaaaatat--ggtaccgttttcatgtatgtaaattggaaaatttccataattgttcttcatccagtctagcacacct |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
25321075 |
attgaataattatcataaatttgaaaaatatatggtaccgttttcatgtatgtaaattggaaactttccataattgttcttcatccagtctagcacacct |
25321174 |
T |
 |
| Q |
217 |
tgcaaaatccatggtgtaattggatt |
242 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
25321175 |
tgcaaaatccatggtgtaattggatt |
25321200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 152 - 199
Target Start/End: Original strand, 25326881 - 25326928
Alignment:
| Q |
152 |
taccgttttcatgtatgtaaattggaaaatttccataattgttcttca |
199 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25326881 |
taccattttcatgtatgtaaattggaaaatttccataatcattcttca |
25326928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University