View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11832_high_11 (Length: 337)
Name: NF11832_high_11
Description: NF11832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11832_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 3e-85; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 10 - 193
Target Start/End: Original strand, 13454365 - 13454548
Alignment:
| Q |
10 |
gcataggttgaaagaaagttttgtatggtcttaaggaggctccaagagcatggaacaccaaaattgagtcctatttctgtcaaggatttgagaaatgtcc |
109 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13454365 |
gcataggttggaagaaagttttgtatggtcttaagcaggccctaagagcatggaacaccaaaattgagtcctatttctgtcaaggatttgagaaatgtcc |
13454464 |
T |
 |
| Q |
110 |
ttatgagcacacgttgtttatttgataatcagtctatatgttgatgatctcgtttttataaatcatgattgtatgattgcaaca |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
13454465 |
ttatgagcacacgttgtttatttgataatcagtctatatgttgatgatctcatttttataaatcatgattttatgattgcaaca |
13454548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 191 - 321
Target Start/End: Original strand, 13454577 - 13454707
Alignment:
| Q |
191 |
acaatgacatatctagaaagactggtttactttttaaggattgaagacaagatggtgatggaattttcgttcatcaacataaatatgcaaaagaacaaat |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13454577 |
acaatgacatatctagaaagactggtttactttttaaggattgaagacaagatggtgatggaattttcgttcatcaacataaatatgcaaaagaacaaat |
13454676 |
T |
 |
| Q |
291 |
cttacaaaagtttggaatggagagttgtaac |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
13454677 |
cttacaaaagtttggaatggagagttgtaac |
13454707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University