View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11833_high_29 (Length: 291)
Name: NF11833_high_29
Description: NF11833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11833_high_29 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 9 - 282
Target Start/End: Original strand, 23503296 - 23503569
Alignment:
| Q |
9 |
agcagagagcaagtgtgatattgctgaagcattagtggctatagagatcccctgaatatggctttcctgctgagctttagttaaaagaccagataggact |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23503296 |
agcatagagcaagtgtgatattgctgaagcattagtggctatagagatcccctgaatatggccttcctgctgagctttagttaaaagaccagataggact |
23503395 |
T |
|
| Q |
109 |
tctgcacatagaatgtacaaatagggggatagaagatccccttgtctaagtcctctctgtagaaagaaagtctcagtaggatggccatttataaggatgg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23503396 |
tctgcacatagaatgtacaaatagggggatagaggatccccttgtctaagtcctctctgtagaaagaaagtctcagtaggatggccatttataaggatgg |
23503495 |
T |
|
| Q |
209 |
agaaggaaacagttttaatgcatctcatgatgacatccaccattttaataggaaaacccattatttttgatgtc |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23503496 |
agaaggaaacagttttaatgcatctcatgatgacatccaccattttaataggaaaacccattatttttgatgtc |
23503569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University