View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11833_high_31 (Length: 286)
Name: NF11833_high_31
Description: NF11833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11833_high_31 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 14 - 286
Target Start/End: Original strand, 14180616 - 14180887
Alignment:
| Q |
14 |
agacgaaagagtaaataataagtttgcagagaaactcaaaacaaagagtacatgtatatatctcaacatctgtagcatcgacacttattaaaggagagtc |
113 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||||||| || |
|
|
| T |
14180616 |
agacgaaagagtaaataataagttcgtagagaaactcaa--caaagagtacatgtatatatctcaacctttgtagcatcgacacttattaaaggagaatc |
14180713 |
T |
|
| Q |
114 |
taatgtcccgcaccgacatatgtgg-tacatacattcaataattccatgttctgaaannnnnnnnggttggtatcgatgtatcaatgtcagtgatgtgtg |
212 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14180714 |
taatgtcccgcaccgacatatgtggttacatacattcaataattccatgttctgaaattattattggttggtatcgatgtatcaatgtcagtgatgtgtg |
14180813 |
T |
|
| Q |
213 |
cagtattcgtgtatgtgtcagtatttcatagatcacagatgttgctctatccatgtgtctctaggatcttttct |
286 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||||| |||||||||||||||||| ||||||| |
|
|
| T |
14180814 |
cagtattcgtgtatgtgtcggtatttcatagatcacagctgttgctccatccatgtgtctctaggagcttttct |
14180887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University