View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11833_low_19 (Length: 346)
Name: NF11833_low_19
Description: NF11833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11833_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 55123678 - 55123925
Alignment:
| Q |
1 |
ttatagtttccggttttctaaattttctcttttaataacattgtagtttgatctacattttgtcgtttgagttattgaattaaaggagttttctcttcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55123678 |
ttatagtttccggttttctaaattttctcttttaataacatggtagtttgctctacattttgtcgtttgagttattgaattaaaggagttttctcttcaa |
55123777 |
T |
 |
| Q |
101 |
tattagtaggataaacactatattattcagcatattaggcttagcatatacatctctctgcacattgcatggtaaaatctaaccataatcgatttaactc |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
55123778 |
tattagtaggataaacactat--tattcagcatattatgcttagcatatacatctctctgcacattgcatggcgaaatctaaccataatcgatttaactc |
55123875 |
T |
 |
| Q |
201 |
ctttcataggttatatgtagagggagttactgctgcaactaagaatattt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55123876 |
ctttcataggttatatgtagagggagttactgctgcaactaagaatattt |
55123925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 250 - 334
Target Start/End: Original strand, 55123950 - 55124034
Alignment:
| Q |
250 |
tattttgaattattattggcactaagcaacattattgtcattattcgatattgttgatgttacctgattgttgtcgctttcatct |
334 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55123950 |
tattttgaattattattggcactaagcaacattattgtcattattcgatattgttgatgttacctgattgttgtcgctttcatct |
55124034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University