View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11833_low_21 (Length: 341)
Name: NF11833_low_21
Description: NF11833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11833_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 22 - 296
Target Start/End: Complemental strand, 41177751 - 41177474
Alignment:
| Q |
22 |
atatatgtggtggttaaacgttttcattcaccttgtaacatatttttgagggatttacctttgtgacatatggtgattaatctttctttgctaaatttag |
121 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41177751 |
atatatgtggtggttaaacgttttcatttaccttgtgacatatttttgagggatttacctttgtgacatatggtgattaatctttctttgctaaatttag |
41177652 |
T |
 |
| Q |
122 |
attttggtggctctataatatttggatttttaattttattggagtgagatctaaatagaagttgtacattttggccactaccactttttcagca---nnn |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
41177651 |
attttggtggctctataatatttggatttttaattttattggagtgagatctaaatagaagttgtacattttggccactaccactttttccgcatttttt |
41177552 |
T |
 |
| Q |
219 |
nnnnncttgtttaaacgatgtgattatgacctgtaccactttgtaacaaacaattacccaattacatacattacatcg |
296 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41177551 |
ttcttcttgtttaaccgatgtgattatgacctgtaccactttgtaacaaaaaattacccaattacatacattacatcg |
41177474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University