View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11833_low_24 (Length: 336)
Name: NF11833_low_24
Description: NF11833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11833_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 19 - 327
Target Start/End: Original strand, 37485236 - 37485544
Alignment:
| Q |
19 |
aaacgtcaccaccttggacggtgccggactcttccacagcttagcaaaagactcttccacttcctcactcaacccatcttccaaaagcaccatatccaca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37485236 |
aaacgtcaccaccttggacggtgccggactcttccacagcttaacaaaagactcttccacttcctcactcaacccatcttccaaaagcaccatatccaca |
37485335 |
T |
 |
| Q |
119 |
agaactctataggacgagtttatcgaaaaaatcccactatcttccggcaaccaccaccacctatccacttcctcccccaaggttatgccctctaacttag |
218 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37485336 |
agaactctataggacgagtttaccgagaaaatcccactatcttccgacaaccaccaccacctatccacttcctcccccaaggttacgccctctaacttag |
37485435 |
T |
 |
| Q |
219 |
ccaagcattcaacaattaaattgttctcccaaaggaaagtacgcctccgccacaaaaagttccaagacacttcatcgttatgcaagacccacaagtcccg |
318 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37485436 |
ccaagcattccacaattaaattgttctcccaaaggaaagtacgtctccgccacaaaaagttccaagacacttcaccgttatgcaagacccacaagtcccg |
37485535 |
T |
 |
| Q |
319 |
gacctttgc |
327 |
Q |
| |
|
||||||||| |
|
|
| T |
37485536 |
gacctttgc |
37485544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University