View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11833_low_32 (Length: 292)
Name: NF11833_low_32
Description: NF11833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11833_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 20 - 278
Target Start/End: Complemental strand, 2760604 - 2760346
Alignment:
| Q |
20 |
atgactatctgcaatcactggaactttcctccacaactaatttagctttttacttctttacctaaaattttgaatcttgtcattattctttggaggataa |
119 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2760604 |
atgactatctgcaatcattggaactttcctccacaactaatttagctttttacttctttacctaaaattttgaatcttgtcattattctttggaggataa |
2760505 |
T |
 |
| Q |
120 |
acttgattagcttttatggaaacatttaaattccgatgacttgcagttgaatgaaatattattttttggagattgatgcatggaaagatctccacttatg |
219 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2760504 |
acttgattagcttttatggaaacattcaaattccgatgacttgcagttgaatgaaatattattttttggagattgatgcatggaaagatctccacttatg |
2760405 |
T |
 |
| Q |
220 |
agaatttggcaatgagagggtgccagatgctctcgttgtcaataatgtagaaagttctt |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2760404 |
agaatttggcaatgagagggtgccagatgctctcgttgtcaataatgtagaaagttctt |
2760346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University