View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11833_low_42 (Length: 267)
Name: NF11833_low_42
Description: NF11833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11833_low_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 105 - 263
Target Start/End: Original strand, 50457747 - 50457905
Alignment:
| Q |
105 |
ggtggcgttgatgaaagttttacaattgtttatgaggagattcgaactctgcctcttgaggttataaaatcaaactcttcccactatctaccctgacatc |
204 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
50457747 |
ggtggcgttaatgaaagttttacaattgtttatgaggagattcgaactctgccactcgaggttataaaatcaaactcttaccactaactaccctgacatc |
50457846 |
T |
 |
| Q |
205 |
taatggactgtcttccttttgttttgcttcttagttgaaaaaatgaggtctaaagtaat |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50457847 |
taatggactgtcttccttttgttttgcttcttagttgaaaaaatgaggtctaaagtaat |
50457905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University