View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11833_low_42 (Length: 267)

Name: NF11833_low_42
Description: NF11833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11833_low_42
NF11833_low_42
[»] chr1 (1 HSPs)
chr1 (105-263)||(50457747-50457905)


Alignment Details
Target: chr1 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 105 - 263
Target Start/End: Original strand, 50457747 - 50457905
Alignment:
105 ggtggcgttgatgaaagttttacaattgtttatgaggagattcgaactctgcctcttgaggttataaaatcaaactcttcccactatctaccctgacatc 204  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |||||| |||||||||||||    
50457747 ggtggcgttaatgaaagttttacaattgtttatgaggagattcgaactctgccactcgaggttataaaatcaaactcttaccactaactaccctgacatc 50457846  T
205 taatggactgtcttccttttgttttgcttcttagttgaaaaaatgaggtctaaagtaat 263  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50457847 taatggactgtcttccttttgttttgcttcttagttgaaaaaatgaggtctaaagtaat 50457905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University