View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11833_low_48 (Length: 242)
Name: NF11833_low_48
Description: NF11833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11833_low_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 45 - 223
Target Start/End: Complemental strand, 30463630 - 30463452
Alignment:
| Q |
45 |
tgagaaaagcttagaaatggtatagggtttatattgtaagatagttttgtgaaggatagagagaacgtgtgttcaaataatggagtgtttggtgagtgaa |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30463630 |
tgagaaaagcttagaaatggtatagggtttatattgtaagatagttttgtgaaggatagagagaacgtgtgttcaaataatggagagtttggtgagtgaa |
30463531 |
T |
 |
| Q |
145 |
gaaattgtagcaatgatatgatttatgttgccatttttggaagtggtgccaagagagtatgtagagaaggagatttgat |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30463530 |
gaaattgtagcaatgatatgatttatgttgccatttttggaagtggtgccaagagagtatgtagagaaggagatttgat |
30463452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University