View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11833_low_49 (Length: 241)
Name: NF11833_low_49
Description: NF11833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11833_low_49 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 6566354 - 6566575
Alignment:
| Q |
1 |
tttcattatcgatgaaagcaaccatgctagaagctacaacttcggcgaagttggcagtagagatgcggtcttcggcctgcttcacgcaaaacccacgttc |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |||||| |||||| ||||||||||||||||||||||||||||||||||||||||| | ||| |
|
|
| T |
6566354 |
tttcattctcgatgaaagcaaccatgctagaagctacagcttcggggaagtttgcagtagagatgcggtcttcggcctgcttcacgcaaaacccgcattc |
6566453 |
T |
|
| Q |
101 |
atcgacaggatttgaacatctataagcagcagcaacgacttttgtgtattcaacattcttnnnnnnnnnnntcaagttcgtgcaaccatgtaccattaaa |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6566454 |
atcgacaagatttgaacatctataagcagcagcaacgacttttgtgtattcaacattctt-aaaaaaaaaatcaagttcgtgcaaccatgtaccattaaa |
6566552 |
T |
|
| Q |
201 |
acttgacttacaaataaacgtat |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
6566553 |
acttgacttacaaataaacgtat |
6566575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University