View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11833_low_56 (Length: 228)
Name: NF11833_low_56
Description: NF11833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11833_low_56 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 2 - 40
Target Start/End: Original strand, 55271104 - 55271142
Alignment:
| Q |
2 |
tgcacttagtgtgaaactgtttcgtcactagattctttg |
40 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55271104 |
tgcacttagtgtgaaactgtttcgtcactagattctttg |
55271142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 174 - 208
Target Start/End: Original strand, 55271280 - 55271314
Alignment:
| Q |
174 |
tgcataggaactaagcttaaaccatcataatttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
55271280 |
tgcataggaactaagcttaaaccatcataatttta |
55271314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University