View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11833_low_57 (Length: 226)
Name: NF11833_low_57
Description: NF11833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11833_low_57 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 1 - 127
Target Start/End: Complemental strand, 41381595 - 41381469
Alignment:
| Q |
1 |
cactctcacacttatcactctcctctagtactacttatacttacttcagtcactcagtgcgttttgttggagagagagaaaaaggattggttcttcttca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41381595 |
cactctcacacttatcactctcctctagtactacttatacttacttcagtcactcagtgcgttttgttggagagagagaaaaagggttggttcttcttca |
41381496 |
T |
 |
| Q |
101 |
aacactgtcttcctgttcttcaagcat |
127 |
Q |
| |
|
|||||||| |||||||||||||||||| |
|
|
| T |
41381495 |
aacactgtgttcctgttcttcaagcat |
41381469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University