View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11833_low_57 (Length: 226)

Name: NF11833_low_57
Description: NF11833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11833_low_57
NF11833_low_57
[»] chr5 (1 HSPs)
chr5 (1-127)||(41381469-41381595)


Alignment Details
Target: chr5 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 1 - 127
Target Start/End: Complemental strand, 41381595 - 41381469
Alignment:
1 cactctcacacttatcactctcctctagtactacttatacttacttcagtcactcagtgcgttttgttggagagagagaaaaaggattggttcttcttca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
41381595 cactctcacacttatcactctcctctagtactacttatacttacttcagtcactcagtgcgttttgttggagagagagaaaaagggttggttcttcttca 41381496  T
101 aacactgtcttcctgttcttcaagcat 127  Q
    |||||||| ||||||||||||||||||    
41381495 aacactgtgttcctgttcttcaagcat 41381469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University