View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11833_low_60 (Length: 205)

Name: NF11833_low_60
Description: NF11833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11833_low_60
NF11833_low_60
[»] chr1 (1 HSPs)
chr1 (48-193)||(6566039-6566187)


Alignment Details
Target: chr1 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 48 - 193
Target Start/End: Complemental strand, 6566187 - 6566039
Alignment:
48 gattagaagatttgtcaaaaatctaaaatctttcacctttccaaactacaa-----aaattcgtctatatgtgtaaaaattatgaaatactaacatgtga 142  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||     ||| ||||||||  ||||||||||||||||||||||||||||||    
6566187 gattaaaagatttgtcaaaaatctaaaatctttcacctttccaaactacaatacaaaaagtcgtctat--gtgtaaaaattatgaaatactaacatgtga 6566090  T
143 ctaatctgagtggcacaagtcactttaaacaagcggtcaatcattcaatct 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
6566089 ctaatctgagtggcacaagtcactttaaacaagcggtcaatcattcaatct 6566039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University