View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11833_low_60 (Length: 205)
Name: NF11833_low_60
Description: NF11833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11833_low_60 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 48 - 193
Target Start/End: Complemental strand, 6566187 - 6566039
Alignment:
| Q |
48 |
gattagaagatttgtcaaaaatctaaaatctttcacctttccaaactacaa-----aaattcgtctatatgtgtaaaaattatgaaatactaacatgtga |
142 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6566187 |
gattaaaagatttgtcaaaaatctaaaatctttcacctttccaaactacaatacaaaaagtcgtctat--gtgtaaaaattatgaaatactaacatgtga |
6566090 |
T |
|
| Q |
143 |
ctaatctgagtggcacaagtcactttaaacaagcggtcaatcattcaatct |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6566089 |
ctaatctgagtggcacaagtcactttaaacaagcggtcaatcattcaatct |
6566039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University